2019-nCoV: is the RT-PCR test reliable?

PCR tests work by detecting specific genetic material within the virus. It amplifies a specific DNA sequence, targeted by the so called Primers, by rapidly make millions to billions of copies in successive heat cycles (very prone to fail due amplified noise).

SARS-CoV-2 has nearly 30,000 nucleotides, the building blocks that make up DNA and RNA. The PCR test targets just 100 nucleotides that are supposed specific to SARS-CoV-2. These 100 nucleotides include two genes in the SARS-CoV-2 genome.

The RT-PCR sample is considered positive if the test finds both genes, inconclusive if just one gene is found, and negative if neither gene is detected. Once a sample arrives at the lab, researchers extract its nucleic acid, which holds the virus' genome. Then, researchers can amplify certain regions of the genome by using a technique known as reverse transcription polymerase chain reaction.

So the key point here is: which are the gene sequences to be targeted? Are they exclusive from the 2019 virus or can appear anywhere else ?

Here you find the primers and seeked sequence supposed exclusive from 2019 coronavirus:

Assay/use	Oligonucleotide	Sequencea	Concentrationb
RdRP gene	RdRp_SARSr-F	GTGARATGGTCATGTGTGGCGG	Use 600 nM per reaction
	RdRp_SARSr-P2	FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ	Specific for 2019-nCoV, will not detect SARS-CoV. Use 100 nM per reaction and mix with P1
	RdRP_SARSr-P1	FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ	Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs. Use 100 nM per reaction and mix with P2
	RdRp_SARSr-R	CARATGTTAAASACACTATTAGCATA	Use 800 nM per reaction
E gene	E_Sarbeco_F	ACAGGTACGTTAATAGTTAATAGCGT	Use 400 nm per reaction
	E_Sarbeco_P1	FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ	Use 200 nm per reaction
	E_Sarbeco_R	ATATTGCAGCAGTACGCACACA	Use 400 nm per reaction
N gene	N_Sarbeco_F	CACATTGGCACCCGCAATC	Use 600 nm per reaction
	N_Sarbeco_P	FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ	Use 200 nm per reaction
	N_Sarbeco_R	GAGGAACGAGAAGAGGCTTG	Use 800 nm per reaction

To perform the test is used E gene assay as the first-line screening tool, followed by confirmatory testing with the RdRp gene assay. Application of the RdRp gene assay can discriminate 2019-nCoV (both probes positive) from SARS-CoV RNA.

How can this be understood by a dummy? Let me explain: the test searches on the fluid sample,
among others, next RNA sequences codified in genes that produce specific proteins, released from the Wuhan cluster that are described as exclusive from 2019-nCoV:

GTGARATGGTCATGTGTGGCGG
CAGGTGGAACCTCATCAGGAGATGC
CCAGGTGGWACRTCATCMGGTGATGC

These sequences codifies 3 different RdRp genes, again in theory specific from 2019-nCoV, not other Coronavirus (which first was discovered on 1960 and is the traditional flu called OC43). RdRp gene targeted to detect 2019-nCoV generates protein Orf1ab (virus open reading frame) which relevant target sequence is described on lines 15361-15460 of Gene database bank (open source site).

15361 aaacatacaa cgtgttgtag cttgtcacac cgtttctata gattagctaa tgagtgtgct    

15421 caagtattga gtgaaatggt catgtgtggc ggttcactat atgttaaacc aggtggaacc

     gene            LINES FROM 266 TO 21555
                     /gene="orf1ab"
     CDS             join(266..13468,13468..21555)
                     /gene="orf1ab"
                     /ribosomal_slippage
                     /note="pp1ab; translated by -1 ribosomal frameshift"
                     /codon_start=1
                     /product="orf1ab polyprotein"
                     /protein_id="QHD43415.1"

Do you get it? RT-PCR is reading in the blood some RNA strings supposed specific from 2019-nCoV in order to trigger escalated reaction and say: "yes-you are 2019-nCov positive"

But has it sense? What happens if these strings may appear also in other virus or on RNA human cells? It will trigger false positive.

Let me do one test, i will get first RNA sequence from Orf1ab gene aaacatacaa and search on GeneBank. What i get? Surprising: this sequence belongs to a homo sapiens gene C1orf109 that you can buy on the clone maketplace by some hundreds dollars.

Now let's do same with catgtgtggc:

and found same, another sequence that appears on a Homo Sapiens gene
ALS2CL cDNA ORF clone, Homo sapiens(human)

Try yourself to do the exercise, get all gene sequences used on RT-PCR as markers for the 2019-nCoV and you will find all of them appear or are very similar to another human gene sequences. This has sense since RNA sequence codifies gene that generates specific proteins, so similar proteins no matter if generated by virus or human has to have similar sequences. Building blocks of the life are common across species.

Let's check another primer sequence:

CCAGGTGGWACRTCATCMGGTGATGC   

that is said specific for 2019-nCoV and will not detect SARSCoV by using100 nM per reaction and mix with P1 

Here the funny thing. This sequence already existed on a older Coronavirus on 2015

"A set of probes for detecting Coronavirus by real-time PCR. The kit should consist of Applied Detection Primers.Biosystems (cat. No. 4304970) 5 ’FAM-CCAggTggWACRTCATCMggTgATgC-3’, the Supplier must provide training onuse of primers and probes and interpretation of real-time PCR results. The kit must be supplied withobserving the temperature regime of -20 ° C"

So another primer ACGATTGTGCATCAGCTGA from COVID-2019-2 can be found on BLAST gene database on Homo sapiens chromosome 2, GRCh38.p12 Primary Assembly, differing only 3 basis.

SUMMARIZING:

A) RT-PCR TEST TO DETECT 2019-NCOV IS NOT RELIABLE SINCE DETECTS VIRUS SEQUENCES THAT ARE EQUAL OR VERY SIMILAR TO OTHERS BELONGING TO HUMAN GENOME OR OLDER CORONAVIRUS. SO IT IS NOT SPECIFIC FOR THE 2019-VIRUS. It means that being positive only confirms that you are human or you may have the older flu.

B) Same official sources assert that: Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.

So what the fuck is that fake test where you can buy primers on the marketplace? It's an excuse of Pharma industry and States to mark you as carrier, steal your freedom and force you to take forever expensive antivirals, well demonstrated immunosupressors, that eventually can kill you. 

Recommendation: DO NOT DO TEST, ignore the outcome if you are healthy. Only go to Hospital if you have serious symptoms.

2019-nCoV: the final harmless natural pill that will cure it

The treatment that may have to be applied on Hospitals is:

a) do not use oxygen masks since may poison carriers, only on severe cases and no longer 30 minutes day.
b) do not apply any kind of drugs, only facilitate breathing to pacients and control fever
c) analyze bi-hourly the serum ferritine in order to detect Cytokin Storm
    b.1) if yes, applies product HEMITHEA intra-venous and apply electrical stimulation of vague nerve
   b.2) if Cytokin lowers, stop applying HEMITHEA and allow pacient rest without any treatment

What consists product HEMITHEA?

Anyone can produce it, it's free and no patent, since the aim is to help humanity, not produce turnover. It contains 500mg of 2-deoxy-D-glucose (2-DG) covered of grain fibers. It is not a drug, it's manufactured sugar with natural additions. Can be ingested via pill or directly to blood as a diluted solution. The aim is to fasting metabolism in order to modulates the IL-12/IL-10 cytokine balance, establishing novel targets for metabolism-based immune-modulation.

How to massively put  it on market?

In order to test safety of the product (is entire sugar and natural, no drug) is needed to perform a trial on 1000 persons older than 60 with mild and medium 2019-nCoV symptoms with 2 pills days, 2 groups (one placebo) and analyze the evolution during 2 weeks (blood pressure, t-cell level, viral charge level, IL level, hear beat, O2 blood level).  If successful and no side effects, next trial has to be done against 100 persons older than 60 with severe respiratory symptoms.

What about current treatments ?

Receiving corticosteroids did not have an effect on mortality, but rather delayed viral clearance. Therefore, corticosteroids should not be routinely given systemically, according to WHO interim guidance. Further evidence is urgently needed to assess whether systematic corticosteroid treatment is beneficial or harmful for patients infected with 2019-nCoV. No antiviral treatment for coronavirus infection has been proven to be effective.

SUMMARIZING: AVOID AT MOST ANTIVIRAL, CORTICOSTEROIDS AND ARTIFICIAL VENTILATION. THEY DON'T WORK AND EVEN CAN KILL YOU FASTER.

2019-nCoV: oxygen masks may explain higher death rate

Let me show some relevant scientific findings related to oxygen therapy:

Were analyzed more than 16,000 adult patients with sepsis, stoke, trauma, emergency surgery, heart attack or cardiac arrest. Analysis of data revealed that, compared to the conservative strategy, liberal administration of oxygen resulted in increased in-hospital death by 21 percent. Additional analyses suggested that the more supplemental oxygen patients were given, the higher their risk was for death. However, the incidence of other conditions, such as infections or length of hospital stay, was similar between the two groups.

So friends, our hospitals are killing (being aware or not) our people (elders and dissidents as shown on the photos).

Oxygen toxicity is a condition resulting from the harmful effects of breathing molecular oxygen at increased partial pressures. Severe cases can result in cell damage and death, with effects most often seen in the central nervous system, lungs, and eyes.

The so called oxygen-derived free radicals, that have been proposed as being the probable etiological cause in the development of oxygen toxicity. Free radicals are generated due to the mitochondrial oxidoreductive processes and also induced by the function of enzymes such as xanthine/urate oxidase at extra-mitochondrial sites, from auto-oxidative reactions, and by phagocytes during the bacterial killing. These free radicals create lipid peroxidations, especially in the cell membranes, subdue nucleic acids and protein synthesis, and mollify cellular enzymes. Continued exposure to high concentrations of oxygen results in heightened free radical production. This may damage the pulmonary epithelium, inactivate the surfactant, form intra-alveolar edema, interstitial thickening, fibrosis, and ultimately lead to pulmonary atelectasis.

Beside that, has been found that 2019-nCoV is associated to fibrosis on radiological findings from 81 patients with 2019-nCoV pneumonia in Wuhan, China.

Here then my hot assertion: 2019-nCov related fibrosis and lung damage that ends in death seems more caused by Cytokin storm (as in wrong named Spanish flu) and long term Oxygen mask exposure (that increases death rate in 20% as shown before) rather than same 2019-nCov.

2019-nCoV hot topics and cure

FEATURES:

2019-nCoV according to Chinese and Indian studies suggest is human created , having as special feature a high mutation rate on spike proteins in charge of attaching to the healthy host cell. That's why this virus has higher transmission rates than SARS and flu. In fact this virus looks more like HIV and Ebola than SARS or flu, since is a enveloped (packaged) virus that can enter the cell through the membrane fusion.

The hot topic discovered on 2019-nCoV is that has HIV insertions on its spike proteins,proofing that is manmade to harm people. There are 4 insertions in the spike glycoprotein (S) which are unique to the 2019-nCoV and are not present in other coronaviruses. Amino acid residues in all them have identity to those in the HIV1 gp120 or HIV-1 Gag. Despite the inserts being discontinuous on the primary amino acid sequence, 3D-modelling of the 2019-nCoV suggests that they converge to constitute the receptor binding site suggesting is unlikely to be fortuitous in nature.

2019-nCoV secreted viral particles to the host cell surface protein GP120 (responsible for binding to the receptor) is the spike protein S1 (responsible for binding to the receptor) and for host cell GP41 (responsible for membrane fusion)  is the S2 (responsible for membrane fusion). Fusion mechanism is similar to HIV and Ebola,by targeting an enzyme called furin, which works as a protein activator in the human body.

ORIGIN:

The unique level 4 (high risk virus handling) Microbiology Laboratory in China is Wuhan's Institute of Virology, that hints virus could have been leaked accidentally from there, knowing that some cases they sold infected animals to the nearby markets to make some extra cash, where the outbreak started.To add more light on the origin of the spread, one article published July 2019 before the outbreak points out a espionage case between Canada and China, in which a Chinese researcher working in a Canadian microbiology institute was  removed credentials from a  level-4 lab. It could be that in the afterwards of the Huawei CFO detention in Canada , China tried to stole pharma assets from that Candian laboratory that ended up in Wuhan with an insufficient caring.

So the rationale design for this biological weapon whoever created it is: let's get an isolated flu, let's attach to it properties of HIV (large dormant period) in order to increase the spread capabilities, let's alter genome to increase mutability rate. Then you get 2019-nCoV. While SARS killed around 10% of patients, 2019-nCoV kills around 2%. The difference is that 2019-nCoV is significantly more contagious so you can achieve more casualities. Covid-19’s ability to bind to cells is 100 to 1,000 times stronger than SARS.

HOW CAN WE FIGHT IT?

Virus are a billionaire lucrative business for pharma industry, that own pensions plans, lobby the supranational organizations that rule the countries (OMS, EU) and influence the most of the national budget, since it is dedicated to healthcare. They will research, provide you a vaccine by amending the original virus, force states to purchase it, and fix the problem for 1 year until next mutation. So do not expect long term or definitive solutions from the mainstream and official sources. Rather think by yourself:

A) ON YOUR SIDE:

Enveloped virus  such 2019-nCoV are the easier to kill, they die at 38 C. How can be achieved?

a) naturally fight via fever

b) artificially: sport, infrared sauna, warm weather. Always to be applied in short periods during day, since long term heat exposure dampens immune system

c) sleeping, where natural immune system kills pathogens

Was it easy? Let me show you a personal sample. Last 2 years i have had an average of only 2-3 days fever per year on winter, at upper respiratory system. I do regularly sport and sauna. Last time i took antibiotics was 3 years ago. However my partner is having almost 1 month per year, my relatives (mother, sister) 2-3 weeks years, including lower lung affections. They do not have these habits at all and rely continuously on antibiotics. The kind of sport i do is weight workout, 1 h 30 min each 48 hours. Sauna 15 min at the end. I run 30' per week for 5 km. I found out that intensive cardiovascular training such marathons is worst and immunosupressant. Some colleagues of mine running 40 km week get longer colds (2 weeks).

b) helps to achieve better c). People stressed , with panic to the virus, being tagged as 2019-nCoV carriers, confined to hospitals (a big source of other diseases) do not sleep properly. Lack of sleeping is immunosupressant and ends killing you. What should you do if feeling mild symptoms?  Confine yourself at home having no one closer than 1 meter. Try to do b) in an isolated environment and do not stop at all you habits. Sleeping profoundly without durgs is crucial. Logically if serious lung complications you have to go to the doctor.

B) RESEARCHERS:

Human body contains a full human virome specially on the intestine. So we live with thousands of virus all our life. Blood analysis on healthy people finds Herpesviridae, Influenzavirus, RNA virus such HIV, coronavirus, etc with no problems. Virus is a parasite that needs a live host to spread it. There is no interest at all in killing it. In fact we are macroscopic virus. The problem is the viral load. When the higher, then is associated the disease symptoms. Viral load is caused by bad behaviour of own immune system. 

So why people (elderly) dies from 2019-nCoV ?  They do not die because virus, they die due to the exaggerated own immune response that stiffens, floods and damages the lung cells, provoking respiratory insufficiency. They die from friendly fire attack on the form of holes and scars on lung tissues created by the immune system’s hyperactive response.

Therefore why pharma industry insists in killing/deactivating the virus with antivirals/vaccines instead controlling properly the own immune system reaction? Because first can be sold on the market in form of a drug, that provide seasonal solution (no matter side effects that can be diluted in unprofessional testings such Monsanto-Roundup case). 

So the right and fast pathway is to learn how to control cytokines level in blood, since they are proteins used by the immune system as alarm beacons. So affected carriers being following up periodically by specialized doctors at home and applying agents to reduce cytokin storm via antinflammatories can be the solution. Although excessive inflammatory responses are harmful to lung tissue, inflammatory cells are essential for repair and regeneration because these cells are important cleaners that remove harmful pathogens as well as debris derived from apoptotic and necrotic cells. Inflammatory cells, especially phagocytic monocytes including alveolar macrophages, produce cytokines and growth factors to resolve inflammation and promote tissue repair and regeneration by inducing tissue-resident stem cells.

So the key point i would recommend to Pharma industry and researchers is to invest and focus on having formulas to keep a balanced level of inflammatory response, instead of deep diving on expensive spike DNA rendering and vaccines manufacturing, that do not solve the problem at long term, has side effects and could end again in leakage of harmful virus from laboratories.